Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGL4-ERSE1-luc2P-Hygro
(Plasmid #101789)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101789 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL4.29
  • Backbone manufacturer
    Promega
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3xERSE-I
  • Species
    Synthetic
  • Insert Size (bp)
    93
  • Promoter minimal TATA-box promoter with low basal activity
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer ctaactggccggtacctgag
  • 3′ sequencing primer aacagtaccggattgccaag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4-ERSE1-luc2P-Hygro was a gift from Seiichi Oyadomari (Addgene plasmid # 101789 ; http://n2t.net/addgene:101789 ; RRID:Addgene_101789)
  • For your References section:

    Dkk3/REIC, an N-glycosylated Protein, Is a Physiological Endoplasmic Reticulum Stress Inducer in the Mouse Adrenal Gland. Fujita H, Bando T, Oyadomari S, Ochiai K, Watanabe M, Kumon H, Ohuchi H. Acta Med Okayama. 2020 Jun;74(3):199-208. doi: 10.18926/AMO/59950. 10.18926/AMO/59950 PubMed 32577017