pGL4-AARE-luc2P-Hygro
(Plasmid #101787)

• Purpose: Luferase reporter plasmid containing three tandem repeats of the amino acid response element (AARE)
• Depositing Lab: Seiichi Oyadomari
• Publication: Miyake et al FASEB J. 2016 Feb;30(2):798-812. doi: 10.1096/fj.15-275990. Epub 2015 Oct 20.

Backbone

• Vector backbone: pGL4.29
• Backbone manufacturer: Promega
• Vector type: Mammalian Expression, Luciferase
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3xAARE
• Species: Synthetic
• Insert Size (bp): 63
• Promoter: minimal TATA-box promoter with low basal activity
• Tag / Fusion Protein:
  • Luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: ctaactggccggtacctgag
• 3′ sequencing primer: aacagtaccggattgccaag

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry