H14_MBP_SUMO-Cys-linker-BAF
(Plasmid #101777)

• Purpose: Expresses His-MBP-tagged BAF in E.coli (SUMO-cleavable)
• Depositing Lab: Daniel Gerlich
• Publication: Samwer et al Cell. 2017 Aug 24;170(5):956-972.e23. doi: 10.1016/j.cell.2017.07.038.

Backbone

• Vector backbone: custom bacterial expression vector
• Backbone size w/o insert (bp): 5517
• Total vector size (bp): 5784
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BAF (BANF1)
• Species: H. sapiens (human)
• Insert Size (bp): 267
• Entrez Gene: BANF1 (a.k.a. BAF, BCRP1, D14S1460, NGPS)
• Promoter: T5
• Tag / Fusion Protein:
  • His14-MBP-SUMO (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGTCGTCAGACTGTCGATGAAGCC
• 3′ sequencing primer: GTTCTGAGGTCATTACTGG

Resource Information

• Supplemental Documents:
  • 1289_H14_MBP_SUMO-Cys-linker-BAF.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry