Skip to main content
Addgene

EGFP-BAF_L58R
(Plasmid #101776)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101776 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Addgene plasmid # 52962
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 10400
  • Total vector size (bp) 10667
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BAF (BANF1)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    267
  • Mutation
    L58R mutation
  • Entrez Gene
    BANF1 (a.k.a. BAF, BCRP1, D14S1460, NGPS)
  • Promoter EF1a
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATGCCCGCTTTTGAGA
  • 3′ sequencing primer TAAGTGCAGTAGTCGCCGTGAACGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-BAF_L58R was a gift from Daniel Gerlich (Addgene plasmid # 101776 ; http://n2t.net/addgene:101776 ; RRID:Addgene_101776)
  • For your References section:

    DNA Cross-Bridging Shapes a Single Nucleus from a Set of Mitotic Chromosomes. Samwer M, Schneider MWG, Hoefler R, Schmalhorst PS, Jude JG, Zuber J, Gerlich DW. Cell. 2017 Aug 24;170(5):956-972.e23. doi: 10.1016/j.cell.2017.07.038. 10.1016/j.cell.2017.07.038 PubMed 28841419