-
PurposeExpresses EGFP tagged BAF in human cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101772 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAddgene plasmid # 52962
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 10400
- Total vector size (bp) 10667
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin ; BleoR marker is outside of LTR and will not be packaged into virus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBAF (BANF1)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)267
-
Entrez GeneBANF1 (a.k.a. BAF, BCRP1, D14S1460, NGPS)
- Promoter EF1a
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATGCCCGCTTTTGAGA
- 3′ sequencing primer TAAGTGCAGTAGTCGCCGTGAACGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-BAF was a gift from Daniel Gerlich (Addgene plasmid # 101772 ; http://n2t.net/addgene:101772 ; RRID:Addgene_101772) -
For your References section:
DNA Cross-Bridging Shapes a Single Nucleus from a Set of Mitotic Chromosomes. Samwer M, Schneider MWG, Hoefler R, Schmalhorst PS, Jude JG, Zuber J, Gerlich DW. Cell. 2017 Aug 24;170(5):956-972.e23. doi: 10.1016/j.cell.2017.07.038. 10.1016/j.cell.2017.07.038 PubMed 28841419