Skip to main content
Addgene

pET28a-FgßF3-ddFLN4-HIS-ybbr
(Plasmid #101743)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101743 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28a
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5216
  • Total vector size (bp) 5684
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    FgßF3 peptide, ddFLN4 fingerprint
  • Species
    H. sapiens (human); Dictyostelium discoideum
  • Insert Size (bp)
    468
  • Mutation
    C18S in ddFLN4, added 9F in FgßF3
  • Entrez Gene
    FGB (a.k.a. HEL-S-78p)
  • Promoter T7
  • Tags / Fusion Proteins
    • HIS (C terminal on insert)
    • ybbr (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-FgßF3-ddFLN4-HIS-ybbr was a gift from Hermann Gaub (Addgene plasmid # 101743 ; http://n2t.net/addgene:101743 ; RRID:Addgene_101743)
  • For your References section:

    Molecular mechanism of extreme mechanostability in a pathogen adhesin. Milles LF, Schulten K, Gaub HE, Bernardi RC. Science. 2018 Mar 30;359(6383):1527-1533. doi: 10.1126/science.aar2094. 10.1126/science.aar2094 PubMed 29599244