pAAV hSyn1 YFP-CaRhAC
(Plasmid #101721)

• Purpose: Yellow fluorescent protein (YFP) – tagged rhodopsin adenylyl cyclase created from the rhodopsin guanylyl cyclase of Catenaria anguillulae with a neuron-specific promoter. Useful for raising intracellu
• Depositing Lab: Thomas Oertner
• Publication: Scheib et al Nat Commun. 2018 May 24;9(1):2046. doi: 10.1038/s41467-018-04428-w.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 6386
• Total vector size (bp): 7149
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: YFP CaRhAC
• Species: Cateneraria anguillulae
• Promoter: hSyn1
• Tag / Fusion Protein:
  • YFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: StuI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: gactcagcgctgcctcagtctg
• 3′ sequencing primer: GTAATCCAGAGGTTGATTATCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The Insert was a gift from G.Nagel University Wuerzburg-Germany

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry