pET28a-ybbr-HIS-ddFLN4-Fgß
(Plasmid #101719)

• Purpose: wildtype Fgß peptide with ddFLN4 fingerprint domain with N-terminal ybbr tag for covalent immobilization - resulting in weak forces
• Depositing Lab: Hermann Gaub
• Publication: Milles et al Science. 2018 Mar 30;359(6383):1527-1533. doi: 10.1126/science.aar2094.

Backbone

• Vector backbone: pET28a
• Backbone manufacturer: EMD Biosciences
• Backbone size w/o insert (bp): 5216
• Total vector size (bp): 5651
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: ddFLN4 fingerprint, Fgß peptide
• Species: H. sapiens (human); Dictyostelium discoideum
• Insert Size (bp): 435
• Mutation: C18S in ddFLN4
• Entrez Gene: FGB (a.k.a. HEL-S-78p)
• Promoter: T7
• Tags / Fusion Proteins:
  • HIS (N terminal on insert)
  • ybbr (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: CTAGTTATTGCTCAGCGGT

Resource Information

• Supplemental Documents:
  • pET28a-ybbr-HIS-ddFLN4(C18S)-Fgbeta.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry