pET28a-ClfB_N2N3-HIS-ybbr
(Plasmid #101717)

• Purpose: ClfB N2 and N3 domains with C-terminal ybbr tag for covalent immobilization
• Depositing Lab: Hermann Gaub
• Publication: Milles et al Science. 2018 Mar 30;359(6383):1527-1533. doi: 10.1126/science.aar2094.

Backbone

• Vector backbone: pET28a
• Backbone manufacturer: EMD Biosciences
• Backbone size w/o insert (bp): 5216
• Total vector size (bp): 6350
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: ClfB_N2N3
• Alt name: Staphylococcus aureus Clumping factor B
• Species: Staphylococcus aureus
• Insert Size (bp): 1134
• GenBank ID: BA000018
• Promoter: T7
• Tags / Fusion Proteins:
  • H3V 3C (C terminal on insert)
  • HIS (C terminal on insert)
  • ybbr (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: CTAGTTATTGCTCAGCGGT

Resource Information

• Supplemental Documents:
  • pET28a-ClfB-HIS-ybbr.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry