pAAV hSyn1 ChR2 ET-TC 2A tDimer
(Plasmid #101361)

• Purpose: High efficiency channelrhodopsin, neuron specific promoter, red fluorescent protein
• Depositing Lab: Thomas Oertner
• Publication: Berndt et al Proc Natl Acad Sci U S A. 2011 May 3;108(18):7595-600. doi: 10.1073/pnas.1017210108. Epub 2011 Apr 19.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4606
• Total vector size (bp): 7012
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Channelrhodopsin-2
• Alt name: ChR2 E123T-T159C
• Species: Chlamydomonas
• Insert Size (bp): 927
• Mutation: E123T , T159C
• Promoter: human Synapsin

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: gactcagcgctgcctcagtctg
• 3′ sequencing primer: GCGGTGA CGTGGAGGA GAATC

Gene/Insert 2

• Gene/Insert name: synaptophysin-red fluorescent protein
• Alt name: tdimer2
• Species: Discosoma sp.
• Insert Size (bp): 1395
• Promoter: human Synapsin

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ggcagaggaagtcttctaacat
• 3′ sequencing primer: cgataatcaacctctggattac

Resource Information

• Supplemental Documents:
  • pAAV-Syn-ChR _E123T_T159C-2A-tDimer.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ChR originally from P.Hegemann, HU-Berlin Germany
tDimer originally from R-Tsien USD USA