-
PurposeGenetically encoded voltage indicator ASAP2s expressed under strong mammalian promoter (CAG)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1/Puro-CAG
-
Backbone manufacturerInvitrogen/Dr. Paulmurugan Ramasamy
- Backbone size w/o insert (bp) 6107
- Total vector size (bp) 7389
-
Modifications to backboneIn pcDNA3.1/Puro-CAG, the cytomegalovirus enhancer and chicken beta-actin promoter replace the cytomegalovirus enhancer-promoter of pcDNA3.1-Puro.
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameASAP2s
-
SpeciesSynthetic
-
Insert Size (bp)1281
-
GenBank IDMF682491
- Promoter CAG
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The next-generation JEDI-2P sensors are available at: https://www.addgene.org/browse/article/28223314/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1/Puro-CAG-ASAP2s was a gift from Francois St-Pierre (Addgene plasmid # 101274 ; http://n2t.net/addgene:101274 ; RRID:Addgene_101274) -
For your References section:
Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators. Chamberland S, Yang HH, Pan MM, Evans SW, Guan S, Chavarha M, Yang Y, Salesse C, Wu H, Wu JC, Clandinin TR, Toth K, Lin MZ, St-Pierre F. eLife. 2017 Jul 27;6. pii: e25690. doi: 10.7554/eLife.25690. 10.7554/eLife.25690 PubMed 28749338