F40 tension sensor
(Plasmid
#101252)
-
PurposeExpresses the F40-based tension sensor module. The biosensor allows force measurements at 1-6 pN.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101252 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLPCX
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6238
- Total vector size (bp) 7810
-
Modifications to backbonemodified multicloning site
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameYPet(short)-F40-mCherry
-
Alt nameF40 tension sensor module
-
Insert Size (bp)1524
- Promoter CMV
-
Tags
/ Fusion Proteins
- cysteine (N terminal on insert)
- cysteine (C terminal on insert)
- His-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
F40 tension sensor was a gift from Carsten Grashoff (Addgene plasmid # 101252 ; http://n2t.net/addgene:101252 ; RRID:Addgene_101252) -
For your References section:
Extracellular rigidity sensing by talin isoform-specific mechanical linkages. Austen K, Ringer P, Mehlich A, Chrostek-Grashoff A, Kluger C, Klingner C, Sabass B, Zent R, Rief M, Grashoff C. Nat Cell Biol. 2015 Dec;17(12):1597-606. doi: 10.1038/ncb3268. Epub 2015 Nov 2. 10.1038/ncb3268 PubMed 26523364