pCZGY3163
(Plasmid #101248)

• Purpose: GFP11::rps-18, ribosomal protein subunit, bound to C-terminal part of GFP. Shows GFP localized to ribosomes when combined with GFP 1-10.
• Depositing Lab: Yishi Jin
• Publication: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

Backbone

• Vector backbone: pCR8 Gateway Entry Vector
• Backbone size w/o insert (bp): 3545
• Total vector size (bp): 4320
• Vector type: Gateway

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: gfp11::rps-18
• Species: C. elegans (nematode), Synthetic
• Insert Size (bp): 775
• Entrez Gene: rps-18 (a.k.a. CELE_Y57G11C.16)
• Tag / Fusion Protein:
  • GFP11

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: ccctctactcaatttcagcaaaaa
• 3′ sequencing primer: tctttaataatgtttgcctcgatc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

When using this clone for publication, please reference:
Noma K, Goncharov A, Ellisman MH, Jin Y. Microtubule-dependent ribosome localization in C. elegans neurons. Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.