pCZGY2254
(Plasmid #101247)

• Purpose: GFP subunits 1-10, (only shows active fluorescence when binds to GFP11)
• Depositing Lab: Yishi Jin
• Publication: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

Backbone

• Vector backbone: pCR8 Gateway Entry Vector
• Backbone size w/o insert (bp): 2855
• Total vector size (bp): 3523
• Vector type: Gateway

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: gfp1-10
• Species: Synthetic
• Insert Size (bp): 668
• Tag / Fusion Protein:
  • GFP1-10

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: TGTAAAACGACGGCCAGT
• 3′ sequencing primer: CAGGAAACAGCTATGACCATG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

When using this clone for publication, please reference:
Noma K, Goncharov A, Ellisman MH, Jin Y. Microtubule-dependent ribosome localization in C. elegans neurons. Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.