pRSETb-ffDronpa-F
(Plasmid #101193)

• Purpose: A fast switching Dronpa variant
• Depositing Lab: Peter Dedecker
• Publication: Duwe et al Chem Commun (Camb). 2017 Jun 29;53(53):7242-7245. doi: 10.1039/c7cc02344h.

Backbone

• Vector backbone: pRSETb
• Backbone size w/o insert (bp): 2860
• Total vector size (bp): 3535
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ffDronpa-F
• Alt name: Dronpa K45I V60A F173V
• Insert Size (bp): 675
• Mutation: K45I, V60A, F173V
• Promoter: T7
• Tags / Fusion Proteins:
  • 6xHis (N terminal on backbone)
  • T7 tag (N terminal on backbone)
  • Xpress tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGTTATTGCTCAGCGGTGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry