Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FL tension sensor module
(Plasmid #101170)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101170 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLPCX
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6238
  • Total vector size (bp) 7936
  • Modifications to backbone
    modified multi cloning site
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    YPet(short)-FL-mCherry
  • Alt name
    FL tension sensor module
  • Insert Size (bp)
    1650
  • Promoter CMV
  • Tags / Fusion Proteins
    • cysteine (N terminal on insert)
    • cysteine (C terminal on insert)
    • His-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FL tension sensor module was a gift from Carsten Grashoff (Addgene plasmid # 101170 ; http://n2t.net/addgene:101170 ; RRID:Addgene_101170)
  • For your References section:

    Multiplexing molecular tension sensors reveals piconewton force gradient across talin-1. Ringer P, Weissl A, Cost AL, Freikamp A, Sabass B, Mehlich A, Tramier M, Rief M, Grashoff C. Nat Methods. 2017 Nov;14(11):1090-1096. doi: 10.1038/nmeth.4431. Epub 2017 Sep 18. 10.1038/nmeth.4431 PubMed 28945706