-
PurposeExpresses the FL-based tension sensor module. The biosensor allows force measurements at 3-5 pN.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101170 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLPCX
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6238
- Total vector size (bp) 7936
-
Modifications to backbonemodified multi cloning site
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameYPet(short)-FL-mCherry
-
Alt nameFL tension sensor module
-
Insert Size (bp)1650
- Promoter CMV
-
Tags
/ Fusion Proteins
- cysteine (N terminal on insert)
- cysteine (C terminal on insert)
- His-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FL tension sensor module was a gift from Carsten Grashoff (Addgene plasmid # 101170 ; http://n2t.net/addgene:101170 ; RRID:Addgene_101170) -
For your References section:
Multiplexing molecular tension sensors reveals piconewton force gradient across talin-1. Ringer P, Weissl A, Cost AL, Freikamp A, Sabass B, Mehlich A, Tramier M, Rief M, Grashoff C. Nat Methods. 2017 Nov;14(11):1090-1096. doi: 10.1038/nmeth.4431. Epub 2017 Sep 18. 10.1038/nmeth.4431 PubMed 28945706