Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUDP044
(Plasmid #101168)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101168 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUDP004
  • Backbone manufacturer
    JM Daran
  • Backbone size w/o insert (bp) 10664
  • Total vector size (bp) 11076
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    amdS (acetamidase gene conferring growth on acetamide)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    polycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
  • gRNA/shRNA sequence
    CTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCGTGAATAATATTCTGAGCTAGTT TTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGC ACCGAGTCGGTGCTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAA CATGCTTCGGCATGGCGAATGGGACACAGCGCAAAATTAGGCTGATGAGTCCGTGAGGAC GAAACGAGTAAGCTCGTCCCTAATTTGTTGTGTATCTTGTTTTAGAGCTAGAAATAGCAA GTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTGG CCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAA TGGGAC
  • Species
    S. cerevisiae (budding yeast); S. pastorianus
  • GenBank ID
    1429090
  • Promoter ScTDH3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CTAAGAACTATGCGAGGACACGC
  • 3′ sequencing primer TGGCTATACCTATCCGTCTACG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The Spcas9D147Y P411T gene presents on pUDP004, pUDP012 and pUDP044 is derived from pCT (Plasmid #60620) obtained from Addgene under Material Transfer Agreement Instructions (Order 211742- our reference TNW15.216)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUDP044 was a gift from Jean-Marc Daran (Addgene plasmid # 101168 ; http://n2t.net/addgene:101168 ; RRID:Addgene_101168)
  • For your References section:

    CRISPR-Cas9 mediated gene deletions in lager yeast Saccharomyces pastorianus. de Vries ARG, de Groot PA, van den Broek M, Daran JG. Microb Cell Fact. 2017 Dec 5;16(1):222. doi: 10.1186/s12934-017-0835-1. 10.1186/s12934-017-0835-1 [pii] PubMed 29207996