pUDP010
(Plasmid
#101166)
-
PurposeE. coli/S. cerevisiae amdS shuttle vector expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 in S. pastorianus (HH-gRNASeILV6-HDV)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101166 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUDP003
- Backbone size w/o insert (bp) 5868
- Total vector size (bp) 6059
-
Vector typeYeast Expression, CRISPR
-
Selectable markersamdS (acetamidase gene conferring growth on acetamide)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHH-gRNA-HDV targetting SeILV6 in S. pastorianus
-
gRNA/shRNA sequenceGGTCTCGCAAACAATTCCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCGAATTGCTTTTCTCTGATTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACACAGCGAGACC
-
SpeciesS. cerevisiae (budding yeast); S. pastorianus
-
GenBank ID1429090
- Promoter ScTDH3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer CTAAGAACTATGCGAGGACACGC
- 3′ sequencing primer CTGCTGATGTCTGGCTATACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUDP010 was a gift from Jean-Marc Daran (Addgene plasmid # 101166 ; http://n2t.net/addgene:101166 ; RRID:Addgene_101166) -
For your References section:
CRISPR-Cas9 mediated gene deletions in lager yeast Saccharomyces pastorianus. de Vries ARG, de Groot PA, van den Broek M, Daran JG. Microb Cell Fact. 2017 Dec 5;16(1):222. doi: 10.1186/s12934-017-0835-1. 10.1186/s12934-017-0835-1 [pii] PubMed 29207996