-
Purposeto epress PCP-GFP fusion protein
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 101161 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneplenti
- Total vector size (bp) 8000
-
Vector typeLentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePCP-GFP
- Promoter Ubc
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTCCAGAGAGCGGAACAGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PCP-GFP was a gift from Mazhar Adli (Addgene plasmid # 101161 ; http://n2t.net/addgene:101161 ; RRID:Addgene_101161) -
For your References section:
Live cell imaging of low- and non-repetitive chromosome loci using CRISPR-Cas9. Qin P, Parlak M, Kuscu C, Bandaria J, Mir M, Szlachta K, Singh R, Darzacq X, Yildiz A, Adli M. Nat Commun. 2017 Mar 14;8:14725. doi: 10.1038/ncomms14725. 10.1038/ncomms14725 PubMed 28290446
