Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

T7-CMVtrans-FFLuc-polyA
(Plasmid #101156)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101156 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Promega L482A
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 2678
  • Total vector size (bp) 4331
  • Modifications to backbone
    Sequence modified from T7 promoter to ATG of the luciferase AGACCCAAGCTTTCAGATCCGCTAGCGCTACCGGGGATCCagccacc
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Firefly luciferase
  • Alt name
    FFluc
  • Species
    Photinus pyralis
  • Insert Size (bp)
    1653
  • Promoter T7 promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AATACGCAAACCGCCTCTC
  • 3′ sequencing primer GGTGATGTCGGCGATATAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Promega

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is only for the production of transcript not for expression in mammalian cells.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    T7-CMVtrans-FFLuc-polyA was a gift from Marcel Bruchez (Addgene plasmid # 101156 ; http://n2t.net/addgene:101156 ; RRID:Addgene_101156)
  • For your References section:

    In Vitro Reversible Translation Control Using gammaPNA Probes. Canady TD, Telmer CA, Oyaghire SN, Armitage BA, Bruchez MP. J Am Chem Soc. 2015 Aug 19;137(32):10268-75. doi: 10.1021/jacs.5b05351. Epub 2015 Aug 4. 10.1021/jacs.5b05351 PubMed 26241615