-
PurposeFluorescent protein for superresolution imaging and a focal adhesion protein for binding substrate
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 101151 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepEYFP-N1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman codon optimized mMaple3 fused to zyxin
-
SpeciesH. sapiens (human), Synthetic
- Promoter cmv
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGCTCTGAGCCCATCATGC
- 3′ sequencing primer GGACAAACCACAACTAGAATGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZyxin-mMaple3 was a gift from Xiaowei Zhuang (Addgene plasmid # 101151 ; http://n2t.net/addgene:101151 ; RRID:Addgene_101151) -
For your References section:
Characterization and development of photoactivatable fluorescent proteins for single-molecule-based superresolution imaging. Wang S, Moffitt JR, Dempsey GT, Xie XS, Zhuang X. Proc Natl Acad Sci U S A. 2014 Jun 10;111(23):8452-7. doi: 10.1073/pnas.1406593111. Epub 2014 May 27. 10.1073/pnas.1406593111 PubMed 24912163
