pACP-ADRβ2 Control Plasmid
(Plasmid #101128)

• Purpose: Expression of ACP-Tagged β2 Adrenergic Receptor in Mammalian cells
• Depositing Labs: New England Biolabs, Ana Egana
• Publication: Egana Lab NEB plasmids (unpublished)

Backbone

• Vector backbone: pACP
• Backbone size w/o insert (bp): 6824
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418) ; Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Beta-2-Adrenergic Receptor
• Alt name: ADRBeta2
• Alt name: ADRB2
• Species: H. sapiens (human)
• Insert Size (bp): 1239
• Entrez Gene: ADRB2 (a.k.a. ADRB2R, ADRBR, ARB2, B2AR, BAR, BETA2AR)
• Promoter: CMV
• Tag / Fusion Protein:
  • ACP-tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SbfI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: GACGCAAATGGGCGGTAG (CMV Forward Primer)
• 3′ sequencing primer: AGGGAGTACTCACCCCAACA (ST1 Reverse Primer)

Resource Information

• Supplemental Documents:
  • pACP-ADRB2 .gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

Originally cloned by Covalys. The ACP-tag is an N-vector tag. Additional antibiotic resistance to Kanmycin

For more information on this plasmid, please see https://www.addgene.org/depositor-collections/neb-cell-imaging-tags/

This plasmid is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). For more information about commercial rights, please contact NEB's Global Business Development team at .