Skip to main content
Addgene

pACP-ADRβ2 Control Plasmid
(Plasmid #101128)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 101128 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pACP
  • Backbone size w/o insert (bp) 6824
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418) ; Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Beta-2-Adrenergic Receptor
  • Alt name
    ADRBeta2
  • Alt name
    ADRB2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1239
  • Entrez Gene
    ADRB2 (a.k.a. ADRB2R, ADRBR, ARB2, B2AR, BAR, BETA2AR)
  • Promoter CMV
  • Tag / Fusion Protein
    • ACP-tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SbfI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer GACGCAAATGGGCGGTAG (CMV Forward Primer)
  • 3′ sequencing primer AGGGAGTACTCACCCCAACA (ST1 Reverse Primer)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Originally cloned by Covalys. The ACP-tag is an N-vector tag. Additional antibiotic resistance to Kanmycin

For more information on this plasmid, please see https://www.addgene.org/depositor-collections/neb-cell-imaging-tags/

This plasmid is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). For more information about commercial rights, please contact NEB's Global Business Development team at [email protected].

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACP-ADRβ2 Control Plasmid was a gift from New England Biolabs & Ana Egana (Addgene plasmid # 101128 ; http://n2t.net/addgene:101128 ; RRID:Addgene_101128)