pCLIPf-NK1R Control Plasmid
(Plasmid #101125)

• Purpose: Expression of CLIP-tagged Neurokinin-1 Receptor in Mammalian cells
• Depositing Labs: New England Biolabs, Ana Egana
• Publication: Egana Lab NEB plasmids (unpublished)

Backbone

• Vector backbone: pCLIP
• Backbone size w/o insert (bp): 5235
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418) ; Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Neurokinin-1 Receptor, Truncated
• Alt name: NK1R
• Species: H. sapiens (human)
• Insert Size (bp): 1179
• Entrez Gene: TACR1 (a.k.a. NK1R, NKIR, SPR, TAC1R)
• Promoter: CMV
• Tags / Fusion Proteins:
  • 10xHis (C terminal on backbone)
  • CLIP-tag (CLIPf) (N terminal on backbone)
  • FLAG Epitope (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: ATCCCCTGCCACCGGGTGGT (SNAP/CLIP Forward Primer)
• 3′ sequencing primer: CTGGGGCAGGCACTTCCA (SNAP/CLIP Reverse Primer)

Resource Information

• Supplemental Documents:
  • pCLIPf-NK1R .gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

Originally cloned by Covalys. The truncated NK1R is an N-terminal insert. The Flag Epitope is a C-insert. The vector is also resistant to Kanamycin.

For more information on this plasmid, please see https://www.addgene.org/depositor-collections/neb-cell-imaging-tags/

This plasmid is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). For more information about commercial rights, please contact NEB's Global Business Development team at .