pSNAPf-H2B Control Plasmid
(Plasmid #101124)

• Purpose: Expression of SNAP-tagged Histone H2B in mammalian cells
• Depositing Labs: New England Biolabs, Ana Egana
• Publication: Egana Lab NEB plasmids (unpublished)

Backbone

• Vector backbone: pSNAP
• Backbone size w/o insert (bp): 5858
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418) ; Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: histone cluster 1 H2B family member j
• Species: H. sapiens (human)
• Insert Size (bp): 378
• Entrez Gene: H2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
• Promoter: CMV
• Tag / Fusion Protein:
  • SNAP-tag (SNAPf) (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: GACGCAAATGGGCGGTAG (CMV Forward Primer)
• 3′ sequencing primer: AGGGAGTACTCACCCCAACA (ST1 Reverse Primer)

Resource Information

• Supplemental Documents:
  • pSNAPf-H2B.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

Originally cloned at New England Biolabs. The H2B insert is a N-terminal insert.

This plasmid is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). For more information about commercial rights, please contact NEB's Global Business Development team at . For more information on this plasmid, please see https://www.addgene.org/depositor-collections/neb-cell-imaging-tags/