-
PurposeExpress SaCas9 in bacteria with a 6xHis tag for purification
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101086 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET-32 EK/LIC
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse strain Rosetta 2(DE3) for expression.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRISPR-associated protein Cas9/Csn1
-
Alt nameSaCas9
-
Alt nameSauCas9
-
SpeciesStaphylococcus aureus subsp. aureus
-
Insert Size (bp)3192
-
GenBank IDCCK74173.1
- Promoter T7lac
-
Tag
/ Fusion Protein
- TrxA-6xHis-STag (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Entrez Gene ID
CCK74173.1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p6XHis_NLS-SaCas9 was a gift from Rick Tarleton (Addgene plasmid # 101086 ; http://n2t.net/addgene:101086 ; RRID:Addgene_101086) -
For your References section:
Rapid, Selection-Free, High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins. Soares Medeiros LC, South L, Peng D, Bustamante JM, Wang W, Bunkofske M, Perumal N, Sanchez-Valdez F, Tarleton RL. MBio. 2017 Nov 7;8(6). pii: e01788-17. doi: 10.1128/mBio.01788-17. 10.1128/mBio.01788-17 PubMed 29114029