Skip to main content
Addgene

pET28a His tag-FRB-Venus C
(Plasmid #100980)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100980 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET 28a
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5201
  • Total vector size (bp) 5833
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    His-FRB-Venus C
  • Species
    Synthetic
  • Insert Size (bp)
    632
  • Promoter T7
  • Tag / Fusion Protein
    • His tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer ctttgttagcagccggatctc
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a His tag-FRB-Venus C was a gift from Heinrich Leonhardt (Addgene plasmid # 100980 ; http://n2t.net/addgene:100980 ; RRID:Addgene_100980)

  • For your References section:

    Nanoparticle Mediated Delivery and Small Molecule Triggered Activation of Proteins in the Nucleus. Chiu HY, Bates JA, Helma J, Engelke H, Harz H, Bein T, Leonhardt H. Nucleus. 2018 Sep 14. doi: 10.1080/19491034.2018.1523665. 10.1080/19491034.2018.1523665 PubMed 30217128
Related items:
Commonly requested with: