pCAG-c-Myc NLS-FKBP-Venus N-T2A-mRFP
(Plasmid
#100979)
-
PurposeEncodes half of a protein delivery sensor ( NLS-FKBP-VN-T2A-RFP) for expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100979 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG IRES Blasticidin
- Backbone size w/o insert (bp) 6228
- Total vector size (bp) 7877
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namec-Myc NLS-FKBP-Venus N-T2A-mRFP
-
SpeciesSynthetic
-
Insert Size (bp)1649
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer TGGGCAACGTGCTGGTTATTG
- 3′ sequencing primer ATTCCAAGCGGCTTCGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-c-Myc NLS-FKBP-Venus N-T2A-mRFP was a gift from Heinrich Leonhardt (Addgene plasmid # 100979 ; http://n2t.net/addgene:100979 ; RRID:Addgene_100979) -
For your References section:
Nanoparticle Mediated Delivery and Small Molecule Triggered Activation of Proteins in the Nucleus. Chiu HY, Bates JA, Helma J, Engelke H, Harz H, Bein T, Leonhardt H. Nucleus. 2018 Sep 14. doi: 10.1080/19491034.2018.1523665. 10.1080/19491034.2018.1523665 PubMed 30217128