pDRF'- AmTryoshka1;3-GS-L255I
(Plasmid #100966)

• Purpose: Yeast expression of fluorescent sensor reporting the activity of ammonium transceptors. Contains a stable reference LSSmOrange nested within the reporting superfolder cpEGFP.
• Depositing Lab: Wolf Frommer
• Publication: Ast et al Nat Commun. 2017 Sep 5;8(1):431. doi: 10.1038/s41467-017-00400-2.

Backbone

• Vector backbone: pDRf1
• Backbone size w/o insert (bp): 6939
• Total vector size (bp): 9869
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AmTryoshka1;3-GS-L255I
• Alt name: AmTryoshka-GS-L255I
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 2935
• Mutation: L255I
• Entrez Gene: AMT1;3 (a.k.a. AT3G24300, AMMONIUM TRANSPORTER 1;3, ATAMT1;3, ammonium transporter 1;3)
• Promoter: PMA

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: AACAATCGTTAATAATTAATTAATTGG
• 3′ sequencing primer: GAAGTGTCAACAACGTATCTACC

Resource Information

• Supplemental Documents:
  • pDRf1 - AmTryoshka_GS-FN_L255I.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry