pDG458
(Plasmid #100900)

• Purpose: SpCas9 with 2A-EGFP and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.
• Depositing Lab: Paul Thomas
• Publication: Adikusuma et al PLoS One. 2017 Dec 6;12(12):e0187236. doi: 10.1371/journal.pone.0187236. eCollection 2017.

Backbone

• Vector backbone: pSpCas9(BB)-2A-GFP (PX458)
• Backbone size w/o insert (bp): 9288
• Total vector size (bp): 9697
• Modifications to backbone: Insertion of 2nd U6-gRNA scaffold.
• Vector type: Mammalian Expression, Mouse Targeting, CRISPR
• Selectable markers: EGFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: humanized CRISPR associated protein 9
• Alt name: Cas9
• Alt name: hSpCas9
• Species: Streptococcus pyogenes
• Insert Size (bp): 4101
• Promoter: CBh
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TTTATGGCGAGGCGGCGG

Gene/Insert 2

• Gene/Insert name: U6-gRNA scaffold 1
• Insert Size (bp): 342
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: Unknown

Gene/Insert 3

• Gene/Insert name: U6-gRNA scaffold 2
• Insert Size (bp): 343
• Promoter: U6

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: bgh PA F TGCATCGCATTGTCTGAGTAGG

Resource Information

• Supplemental Documents:
  • pDG458.gbk
  • pDG One-Step Cloning Protocol
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Feng Zhang
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Modified from pSpCas9(BB)-2A-GFP (PX458) (https://www.addgene.org/48138/)