Skip to main content
Addgene

(p)odr-3::GFP::EGL-4
(Plasmid #100897)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100897 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pPD49.26
  • Backbone manufacturer
    Andy Fire
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    56-2741: odr-3 promoter
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    2686
  • Promoter odr-3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SphI (unknown if destroyed)
  • 3′ cloning site EcoRV (unknown if destroyed)
  • 5′ sequencing primer atctcaacatagtagatttttaaa
  • 3′ sequencing primer CCAATCCCtatctaaaaaaaca
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    (p)odr-3::GFP::EGL-4 was a gift from Noelle L'Etoile (Addgene plasmid # 100897 ; http://n2t.net/addgene:100897 ; RRID:Addgene_100897)

  • For your References section:

    Nuclear entry of a cGMP-dependent kinase converts transient into long-lasting olfactory adaptation. Lee JI, O'Halloran DM, Eastham-Anderson J, Juang BT, Kaye JA, Scott Hamilton O, Lesch B, Goga A, L'Etoile ND. Proc Natl Acad Sci U S A. 2010 Mar 30;107(13):6016-21. Epub 2010 Mar 10. 10.1073/pnas.1000866107 PubMed 20220099
Related items:
Commonly requested with: