pLKO-sh-Nix
(Plasmid
#100770)
-
PurposeLentiviral expression of shRNA targeting Nix
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100770 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1-puro
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLenti-sh-Nix
-
gRNA/shRNA sequenceCAGTTCCTGGGTGGAGCTA
-
SpeciesH. sapiens (human), R. norvegicus (rat)
-
Insert Size (bp)58
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pLKO-sh-FW:Cgtgacgtagaaagtaataatttcttgg
- 3′ sequencing primer pLKO-sh-RVS:ttgtatgtctgttgctattatgtc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-sh-Nix was a gift from Joseph Gordon (Addgene plasmid # 100770 ; http://n2t.net/addgene:100770 ; RRID:Addgene_100770) -
For your References section:
BNIP3L/Nix-induced mitochondrial fission, mitophagy, and impaired myocyte glucose uptake are abrogated by PRKA/PKA phosphorylation. da Silva Rosa SC, Martens MD, Field JT, Nguyen L, Kereliuk SM, Hai Y, Chapman D, Diehl-Jones W, Aliani M, West AR, Thliveris J, Ghavami S, Rampitsch C, Dolinsky VW, Gordon JW. Autophagy. 2021 Sep;17(9):2257-2272. doi: 10.1080/15548627.2020.1821548. Epub 2020 Oct 12. 10.1080/15548627.2020.1821548 PubMed 33044904