pET28b-HRASLS3-1-132
(Plasmid #100725)

• Purpose: Expression of N-terminal region of human HRASLS3 in E.coli
• Depositing Lab: Byung Il Lee
• Publication: Han et al Protein Expr Purif. 2010 May;71(1):103-7. doi: 10.1016/j.pep.2010.01.018. Epub 2010 Jan 25.

Backbone

• Vector backbone: pET28b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5200
• Total vector size (bp): 5600
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: HRASLS3
• Alt name: PLA2G16
• Alt name: HREV107
• Species: H. sapiens (human)
• Insert Size (bp): 400
• Entrez Gene: PLAAT3 (a.k.a. AdPLA, H-REV107, H-REV107-1, HRASLS3, HREV107, HREV107-1, HREV107-3, HRSL3, PLA2G16, PLAAT-3)
• Promoter: T7 promotor
• Tag / Fusion Protein:
  • His (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG (T7 promoter primer)
• 3′ sequencing primer: CCGCTGAGCAATAACTAGC (T7 terminator primer)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry