pET28b-hTIG3-1-164
(Plasmid
#100724)
-
PurposeFull-length human TIG3 in E.coli expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100724 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5200
- Total vector size (bp) 5700
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRARRES3
-
Alt nameRIG1
-
Alt nameTIG3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)500
-
Entrez GenePLAAT4 (a.k.a. HRASLS4, HRSL4, PLA1/2-3, PLAAT-4, RARRES3, RIG1, TIG3)
- Promoter T7 promotor
-
Tag
/ Fusion Protein
- His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter primer)
- 3′ sequencing primer CCGCTGAGCAATAACTAGC (T7 terminator primer) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28b-hTIG3-1-164 was a gift from Byung Il Lee (Addgene plasmid # 100724 ; http://n2t.net/addgene:100724 ; RRID:Addgene_100724) -
For your References section:
Expression, purification and biochemical characterization of the N-terminal regions of human TIG3 and HRASLS3 proteins. Han BG, Cho JW, Cho YD, Kim SY, Yoon HJ, Song HK, Cheong HK, Jeon YH, Lee DK, Lee S, Lee BI. Protein Expr Purif. 2010 May;71(1):103-7. doi: 10.1016/j.pep.2010.01.018. Epub 2010 Jan 25. 10.1016/j.pep.2010.01.018 PubMed 20100577