pHis-hMTMR1
(Plasmid
#100723)
-
PurposeExpression of human MTMR1 PH-PTP domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5900
- Total vector size (bp) 7439
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMTMR1
-
Alt nameMyotubularin-related protein 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1539
-
MutationContains amino acids 95-607
-
Entrez GeneMTMR1
- Promoter T7
-
Tag
/ Fusion Protein
- His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter primer)
- 3′ sequencing primer CCGCTGAGCAATAACTAGC (T7 terminator primer) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The MTMR1 construct is for structural determination and contains the PH-GRAM and PTPase domains (amino acids 95-607). PTPase activity was confirmed.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHis-hMTMR1 was a gift from Byung Il Lee (Addgene plasmid # 100723 ; http://n2t.net/addgene:100723 ; RRID:Addgene_100723) -
For your References section:
Crystal Structure of Human Myotubularin-Related Protein 1 Provides Insight into the Structural Basis of Substrate Specificity. Bong SM, Son KB, Yang SW, Park JW, Cho JW, Kim KT, Kim H, Kim SJ, Kim YJ, Lee BI. PLoS One. 2016 Mar 28;11(3):e0152611. doi: 10.1371/journal.pone.0152611. eCollection 2016. PONE-D-15-41206 [pii] PubMed 27018598