Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET-PF2050
(Plasmid #100721)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100721 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5900
  • Total vector size (bp) 6660
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PF2050
  • Species
    Pyrococcus furiosus
  • Insert Size (bp)
    760
  • Promoter T7 promotor

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter primer)
  • 3′ sequencing primer CCGCTGAGCAATAACTAGC (T7 terminator primer)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-PF2050 was a gift from Byung Il Lee (Addgene plasmid # 100721 ; http://n2t.net/addgene:100721 ; RRID:Addgene_100721)
  • For your References section:

    Crystal structure of Pyrococcus furiosus PF2050, a member of the DUF2666 protein family. Han BG, Jeong KC, Cho JW, Jeong BC, Song HK, Lee JY, Shin DH, Lee S, Lee BI. FEBS Lett. 2012 May 7;586(9):1384-8. doi: 10.1016/j.febslet.2012.04.004. Epub 2012 Apr 13. 10.1016/j.febslet.2012.04.004 PubMed 22616997