pET-PF2050
(Plasmid
#100721)
-
PurposeExpression of Pyrococcus furiosus PF2050
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5900
- Total vector size (bp) 6660
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePF2050
-
SpeciesPyrococcus furiosus
-
Insert Size (bp)760
- Promoter T7 promotor
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter primer)
- 3′ sequencing primer CCGCTGAGCAATAACTAGC (T7 terminator primer) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-PF2050 was a gift from Byung Il Lee (Addgene plasmid # 100721 ; http://n2t.net/addgene:100721 ; RRID:Addgene_100721) -
For your References section:
Crystal structure of Pyrococcus furiosus PF2050, a member of the DUF2666 protein family. Han BG, Jeong KC, Cho JW, Jeong BC, Song HK, Lee JY, Shin DH, Lee S, Lee BI. FEBS Lett. 2012 May 7;586(9):1384-8. doi: 10.1016/j.febslet.2012.04.004. Epub 2012 Apr 13. 10.1016/j.febslet.2012.04.004 PubMed 22616997