B270 (plasmid expressing ATP1A1 sgSTOP and containing an empty sgRNA-expression cassette)
(Plasmid
#100716)
-
PurposeB52 plasmid expressing ATP1A1 sgSTOP (cloned in BsmBI site) and containing an empty sgRNA-expression cassette (use BbsI for cloning)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100716 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneB52 plasmid expressing ATP1A1 sgSTOP and containing an empty sgRNA-expression cassette
- Total vector size (bp) 2634
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgSTOP targeting ATP1A1 (cloned using BsmBI)
-
gRNA/shRNA sequencesgSTOP ATP1A1: GATCCAAGCTGCTACAGAAG
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GAGGTACCTCGAGGAATTCTCTAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
B270 (plasmid expressing ATP1A1 sgSTOP and containing an empty sgRNA-expression cassette) was a gift from Alberto Ciccia (Addgene plasmid # 100716 ; http://n2t.net/addgene:100716 ; RRID:Addgene_100716) -
For your References section:
CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons. Billon P, Bryant EE, Joseph SA, Nambiar TS, Hayward SB, Rothstein R, Ciccia A. Mol Cell. 2017 Sep 4. pii: S1097-2765(17)30605-6. doi: 10.1016/j.molcel.2017.08.008. 10.1016/j.molcel.2017.08.008 PubMed 28890334