Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

B52 + SMARCAL1 sgSTOP
(Plasmid #100715)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100715 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    B52 expressing expressing SMARCAL1 sgSTOP and containing an empty sgRNA-expression cassette
  • Total vector size (bp) 2636
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgSTOP targeting SMARCAL1 (cloned using BbsI)
  • gRNA/shRNA sequence
    sgRNA SMARCAL1: CAGCATCAGAGGACTAGCTC
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGTACCTCGAGGAATTCTCTAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    B52 + SMARCAL1 sgSTOP was a gift from Alberto Ciccia (Addgene plasmid # 100715 ; http://n2t.net/addgene:100715 ; RRID:Addgene_100715)
  • For your References section:

    CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons. Billon P, Bryant EE, Joseph SA, Nambiar TS, Hayward SB, Rothstein R, Ciccia A. Mol Cell. 2017 Sep 4. pii: S1097-2765(17)30605-6. doi: 10.1016/j.molcel.2017.08.008. 10.1016/j.molcel.2017.08.008 PubMed 28890334