Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDONR207-MpPHOT
(Plasmid #100600)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 100600 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDONR207
  • Vector type
    Gateway entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MpPHOT
  • Species
    Marchantia polymorpha
  • Insert Size (bp)
    3345

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCGCGTTAACGCTAGCATGGATCTC
  • 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONR207-MpPHOT was a gift from Yutaka Kodama (Addgene plasmid # 100600 ; http://n2t.net/addgene:100600 ; RRID:Addgene_100600)
  • For your References section:

    Time Gating of Chloroplast Autofluorescence Allows Clearer Fluorescence Imaging In Planta. Kodama Y. PLoS One. 2016 Mar 30;11(3):e0152484. doi: 10.1371/journal.pone.0152484. eCollection 2016. PONE-D-15-51531 [pii] PubMed 27027881