EMX1*_sgRNA
(Plasmid
#100558)
-
PurposeExpresses EMX1* sgRNA. Target sequence: (G)GAGTCCGAGCAGAAGAAGAA. Same target sequence as #100555, except with an additional 5' G.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100558 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonegRNA_cloning_vector (#41824)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEMX1 sgRNA
-
gRNA/shRNA sequence(G)GAGTCCGAGCAGAAGAAGAA
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer M13F
- 3′ sequencing primer M13R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EMX1*_sgRNA was a gift from Dustin Maly (Addgene plasmid # 100558 ; http://n2t.net/addgene:100558 ; RRID:Addgene_100558) -
For your References section:
Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Rose JC, Stephany JJ, Valente WJ, Trevillian BM, Dang HV, Bielas JH, Maly DJ, Fowler DM. Nat Methods. 2017 Jul 24. doi: 10.1038/nmeth.4368. 10.1038/nmeth.4368 PubMed 28737741