pCW57.1-MAT2A
(Plasmid #100521)

• Purpose: Dox-repressible cDNA expression of MAT2A (dox-off/ tet-off all-in-one vector)
• Depositing Lab: David Sabatini
• Publication: Gu et al Science. 2017 Nov 10;358(6364):813-818. doi: 10.1126/science.aao3265.

Backbone

• Vector backbone: pCW57.1
• Backbone manufacturer: Carson Thoreen at Yale University
• Modifications to backbone: The original pCW57.1 vector was modified: rtTA (reverse tetracycline-controlled transactivator) was replaced with tTA (tetracycline-controlled transactivator (tTA), making this vector Tet-Off. Puromycin was replaced with Blasticidin selection
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MAT2A
• Alt name: AMS2
• Alt name: MATA2
• Species: H. sapiens (human)
• Entrez Gene: MAT2A (a.k.a. MATA2, MATII, SAMS2)
• Promoter: pTight TRE

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: LNCX 5' AGCTCGTTTAGTGAACCGTCAGATC 3'

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry