pCMV_mEm_4GS_LF82_663
(Plasmid
#100456)
-
PurposeMammalian expression of E. coli LF82_663 CDS fused to mEmerald
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100456 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4502
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLF82_663
-
Insert Size (bp)525
- Promoter CMV
-
Tag
/ Fusion Protein
- mEmerald (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ACTTCTGCTCTAAAAGCTGCGG
- 3′ sequencing primer CACTGCATTCTAGTTGTGGTTTGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV_mEm_4GS_LF82_663 was a gift from Alan Huett (Addgene plasmid # 100456 ; http://n2t.net/addgene:100456 ; RRID:Addgene_100456) -
For your References section:
A multi-phenotypic imaging screen to identify bacterial effectors by exogenous expression in a HeLa cell line. Collins A, Huett A. Sci Data. 2018 May 15;5:180081. doi: 10.1038/sdata.2018.81. 10.1038/sdata.2018.81 PubMed 29762554