pCAGGS-PHFF-sh-mBVRA
(Plasmid
#100286)
-
PurposeExpression vector for phycocyanobilin (PCB) synthesis and shRNA for mouse BVRA gene in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100286 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGGS
-
Backbone manufacturerJunichi Miyazaki (Osaka University, Japan)
- Backbone size w/o insert (bp) 4870
- Total vector size (bp) 8551
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
-
Alt namePHFF (synthetic genes)
-
Alt namePcyA (Phycocyanobilin:ferredoxin oxidoreductase), HO1 (Heme Oxigenase 1), Fd (Ferredoxin), Fnr (Ferredoxin-NADP+ reductase)
-
SpeciesThermosynechococcus elongatus bp-1 for PcyA and HO1, and Synechocystis sp. PCC 6803 for Fd and Fnr.
-
Insert Size (bp)3681
-
MutationAll genes are codon-optimized for expression in human cells.
- Promoter CAG promoter
-
Tags
/ Fusion Proteins
- Mitochondria-targeting sequence (MTS), HA, Myc (N terminal on insert)
- FLAG, T7 (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer catgttcatgccttcttctttttcc
- 3′ sequencing primer agatgctcaaggggcttcatgatg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameshRNA for mouse BVRA
-
Alt namesh-mBVRA
-
Insert Size (bp)67
- Promoter H1 promoter
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer See map
- 3′ sequencing primer See map
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Expression vector for Phycocyanobilin (PCB) synthesis in mammalian cells. In addition, shRNA targeting to mouse BVRA is expressed so that PCB is further accumulated.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS-PHFF-sh-mBVRA was a gift from Kazuhiro Aoki (Addgene plasmid # 100286 ; http://n2t.net/addgene:100286 ; RRID:Addgene_100286) -
For your References section:
Efficient synthesis of phycocyanobilin in mammalian cells for optogenetic control of cell signaling. Uda Y, Goto Y, Oda S, Kohchi T, Matsuda M, Aoki K. Proc Natl Acad Sci U S A. 2017 Oct 24. pii: 201707190. doi: 10.1073/pnas.1707190114. 10.1073/pnas.1707190114 PubMed 29078307