pCAGGS-PIF3-mEGFP
(Plasmid #100283)

• Purpose: Expresses PIF3 (1-100 aa) fused with mEGFP in mammalian cells
• Depositing Lab: Kazuhiro Aoki
• Publication: Uda et al Proc Natl Acad Sci U S A. 2017 Oct 24. pii: 201707190. doi: 10.1073/pnas.1707190114.

Backbone

• Vector backbone: pCAGGS
• Backbone manufacturer: Junichi Miyazaki (Osaka University, Japan)
• Backbone size w/o insert (bp): 4870
• Total vector size (bp): 8551
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Phytochrome interacting factor 3
• Alt name: PIF3
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 300
• Mutation: N-terminus (1-100 aa) of PIF3 is used
• GenBank ID: NM_001331838.1
• Entrez Gene: PIF3 (a.k.a. AT1G09530, F14J9.19, F14J9_19, PAP3, PHOTOCURRENT 1, PHYTOCHROME INTERACTING FACTOR 3, PHYTOCHROME-ASSOCIATED PROTEIN 3, POC1, phytochrome interacting factor 3, purple acid phosphatase 3)
• Promoter: CAG promoter
• Tag / Fusion Protein:
  • mEGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: catgttcatgccttcttctttttcc
• 3′ sequencing primer: agatgctcaaggggcttcatgatg

Resource Information

• Supplemental Documents:
  • pCAGGS-PIF3-mEGFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Expression vector of PIF3-mEGFP in mammalian cells. Of note, the expression level of PIF3-mEGFP must be comparable or lower than that of PhyB. We usually co-transfect pCAGGS-PhyB-mCherry-HRasCT and pCAGGS-PIF3-mEGFP plasmids into HeLa cells with lipofection in a 50:1 ratio.