pCAGGS-hPhyB621-mCherry-HRasCT
(Plasmid #100282)

• Purpose: Expresses Phytochrome B (1-621 aa) fused with mCherry and Hras C-terminus in mammalian cells
• Depositing Lab: Kazuhiro Aoki
• Publication: Uda et al Proc Natl Acad Sci U S A. 2017 Oct 24. pii: 201707190. doi: 10.1073/pnas.1707190114.

Backbone

• Vector backbone: pCAGGS
• Backbone manufacturer: Junichi Miyazaki (Osaka University, Japan)
• Backbone size w/o insert (bp): 4870
• Total vector size (bp): 8551
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Phytochrome B (1-621 aa)
• Alt name: PhyB (1-621 aa)
• Species: A. thaliana (mustard weed)
• Mutation: Human codon optimized PhyB (1-621 aa)
• GenBank ID: NM_001335612.1
• Entrez Gene: PHYB (a.k.a. AT2G18790, HY3, MSF3.17, MSF3_17, OOP1, OUT OF PHASE 1, PHYTOCHROME B, phytochrome B)
• Promoter: CAG promoter
• Tag / Fusion Protein:
  • mCherry fused with HRas C-terminus for plasma membrane localization. (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: catgttcatgccttcttctttttcc
• 3′ sequencing primer: agatgctcaaggggcttcatgatg

Resource Information

• Supplemental Documents:
  • pCAGGS-hPhyB621-mCherry-HRasCT.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Expression vector of PhyB621-mCherry-HRasCT in mammalian cells. Of note, the expression level of PIF3-mEGFP must be comparable or lower than that of PhyB. We usually co-transfect pCAGGS-PhyB621-mCherry-HRasCT and pCAGGS-PIF3-mEGFP plasmids into HeLa cells with lipofection in a 50:1 ratio.

mCherry has a G229L mutation that does not affect function.