Skip to main content
Addgene

pET26_MraYaa
(Plasmid #100166)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100166 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET26
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mraY (phospho-MurNAc-pentapeptide translocase)
  • Species
    Aquifex Aeolicus
  • Insert Size (bp)
    1082
  • Promoter T7
  • Tag / Fusion Protein
    • MBP-His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CAGATGTCCGCTTTCTGGTATG
  • 3′ sequencing primer T7_reverse
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET26_MraYaa was a gift from Seok-Yong Lee (Addgene plasmid # 100166 ; http://n2t.net/addgene:100166 ; RRID:Addgene_100166)
  • For your References section:

    Crystal structure of MraY, an essential membrane enzyme for bacterial cell wall synthesis. Chung BC, Zhao J, Gillespie RA, Kwon DY, Guan Z, Hong J, Zhou P, Lee SY. Science. 2013 Aug 30;341(6149):1012-1016. doi: 10.1126/science.1236501. 10.1126/science.1236501 PubMed 23990562