pGL4-Cluster Promoter Delta 1
(Plasmid #100126)

• Purpose: It contains ~1.4Kb of the miR-183/96-182 cluster promoter
• Depositing Lab: Eva Hernando
• Publication: Segura et al Oncotarget. 2017 Apr 18;8(16):26298-26311. doi: 10.18632/oncotarget.15459.

Backbone

• Vector backbone: pGL4
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4334
• Total vector size (bp): 5629
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: miR-183-96-82 Cluster promoter
• Alt name: miR-182 cluster
• Species: H. sapiens (human)
• Insert Size (bp): 1295
• Entrez Gene: MIR182 (a.k.a. MIRN182, miRNA182, mir-182)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: TAGCAAAATAGGCTGTCCCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene's sequencing results found two discrepancies compared to the depositor's sequence: 555delG, 1247G>T. These differences could be SNPs and do not occur near the binding sites of the transcription factors of interest; thus they should not affect plasmid function.