pcDNA3-teLuc c-myc
(Plasmid #100026)

• Purpose: Enhanced red-shifted bioluminescence when paired with diphenylterazine (DTZ)
• Depositing Lab: Huiwang Ai
• Publication: Yeh et al Nat Methods. 2017 Sep 4. doi: 10.1038/nmeth.4400.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Thermo Fisher
• Backbone size w/o insert (bp): 5446
• Total vector size (bp): 6000
• Modifications to backbone: none
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: teLuc, a NanoLuc mutant
• Species: Synthetic
• Insert Size (bp): 555
• Mutation: D19S, D85N, C164H
• GenBank ID: KX963378
• Promoter: CMV
• Tag / Fusion Protein:
  • c-myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: ATTTAGGTGACACTATAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • NanoLuc Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see https://med.virginia.edu/ai-lab/samples/ for Practical Notes describing the use of this plasmid.