-
PurposeTo over-express IGF2BP1 in Adult Erythroblasts using tissue specific promoter with IRES for puromycin selection.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100016 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePLVX-SPTA1-IRES-PURO
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 8485
- Total vector size (bp) 10201
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameInsulin like growth factor 2 mRNA binding protein 1
-
Alt nameIMP-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1734
-
GenBank IDNM_006546.3
-
Entrez GeneIGF2BP1 (a.k.a. CRD-BP, CRDBP, IMP-1, IMP1, VICKZ1, ZBP1)
- Promoter SPTA1 erythroid specific promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CCAGACTTTCAAGAAGAGAA
- 3′ sequencing primer AGGTGTATCTTATACACGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PLVX_SPTA1_IGF2BP1_IRES_PURO was a gift from Jeffery Miller (Addgene plasmid # 100016 ; http://n2t.net/addgene:100016 ; RRID:Addgene_100016) -
For your References section:
IGF2BP1 overexpression causes fetal-like hemoglobin expression patterns in cultured human adult erythroblasts. de Vasconcellos JF, Tumburu L, Byrnes C, Lee YT, Xu PC, Li M, Rabel A, Clarke BA, Guydosh NR, Proia RL, Miller JL. Proc Natl Acad Sci U S A. 2017 Jul 11;114(28):E5664-E5672. doi: 10.1073/pnas.1609552114. Epub 2017 Jun 26. 10.1073/pnas.1609552114 PubMed 28652347