pNOC-CRISPR
(Plasmid
#100008)
-
Purpose(Empty Backbone) Expresses Cas9-Nlux and sgRNA in Nannochloropsis oceanica, contains hygromycin resistance cassette, for integration into genome
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100008 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepNOC-CRISPR-HA
- Backbone size (bp) 12919
-
Vector typeAlgae, Nannochloropsis expression
- Promoter Ribi promoter
-
Selectable markersHygromycin
-
Tag
/ Fusion Protein
- Cas9-Nlux (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GTTAAC ATGGTGTTTACTCTCGAGGAC
- 3′ sequencing primer GCTAGCcaccatGGACGCGTAGTCGGGCACGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNOC-CRISPR was a gift from Eva Farre (Addgene plasmid # 100008 ; http://n2t.net/addgene:100008 ; RRID:Addgene_100008) -
For your References section:
Nontransgenic Marker-Free Gene Disruption by an Episomal CRISPR System in the Oleaginous Microalga, Nannochloropsis oceanica CCMP1779. Poliner E, Takeuchi T, Du ZY, Benning C, Farre EM. ACS Synth Biol. 2018 Apr 20;7(4):962-968. doi: 10.1021/acssynbio.7b00362. Epub 2018 Mar 14. 10.1021/acssynbio.7b00362 PubMed 29518315
Map uploaded by the depositor.
