Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Runx1


Description runt-related transcription factor 1
Also known as Aml1, Cbfa2
Species Rattus norvegicus
Entrez ID 50662

Addgene Alerts

You can receive an email alert when new materials related to this gene are available at Addgene.

Log in to manage alerts

Plasmids containing this gene, or a homologous gene.

ID Plasmid Gene/Insert PI
12426pCMV5-AML1BAML1B (Homo sapiens) Hiebert
12428pCMV-AML1-ETOAML1-ETO fusion (Homo sapiens) Hiebert
12429pUHD-AML1-ETOAML1-ETO (Homo sapiens) Zhang
12430pUHD-HA-AML1-ETOAML1-ETO (Homo sapiens) Zhang
12431MigR1-AEAML1-ETO fusion (Homo sapiens) Zhang
12432MigR1-AEtrC-term truncated AML1-ETO (Homo sapiens) Zhang
12433MigR1-AE9aAML1-ETO9a fusion (Homo sapiens) Zhang
12434MigR1-AE9aPAML1-ETO9a as in t(8;21) patients (Homo sapiens) Zhang
45816pLKO.1 shRUNX1 puroRunx1 (Homo sapiens) Janes
53802Runx1_pCSdestRunx1 (Homo sapiens) Reeves
60832MSCV-AML1/ETO-IRES-GFPAML1/ETO (Homo sapiens) Lowe
97043pINDUCER-21-RUNX1Runt Related Transcription Factor 1 (Homo sapiens) Daley
120475EF1a_RUNX1_P2A_Hygro_BarcodeRUNX1 (Homo sapiens) Mali
139821pFUW-tetO-RUNX1Runx1 (Homo sapiens) Pereira
141887TFORF1919RUNX1 (Homo sapiens) Zhang
142887TFORF1920RUNX1 (Homo sapiens) Zhang
144949TFORF3473RUNX1 (Homo sapiens) Zhang
154089pINDUCER-21-RUNX1-P2A-ERG-IMPROVEDRunt Related Transcription Factor 1, ETS-Related Gene (Homo sapiens) Daley
176974RUNX1_pcDNA6.2/EmGFP-BsdRUNX1 (Homo sapiens) Reeves
181976pLeGO.sgGata1.4.RUNX1A.iG2GATA1 gRNA: CCTAGACCAGGAAAATCCAT (Mus musculus), RUNX1A (Homo sapiens) Klusmann
181977SIN40C.TRE.HA.RUNX1A.IRES.dTomato.PGK.sfGFP.P2A.Tet3GRUNX1A (human) (Homo sapiens) Klusmann
181978SIN40C.TRE.HA.RUNX1C.IRES.dTomato.PGK.sfGFP.P2A.Tet3GRUNX1C (human) (Homo sapiens) Klusmann
181979pRRL.PPT.SFFV.HA.RUNX1A.IRES.eGFPRUNX1A (human) (Homo sapiens) Klusmann
181980pRRL.PPT.SFFV.HA.RUNX1C.IRES.eGFPRUNX1C (human) (Homo sapiens) Klusmann
192928pPB-cT3G-cERP2-RUNX1RUNX1 (Homo sapiens) Church
194574pRK5-mEGFP-RUNX1-WTRUNX1 (Homo sapiens) Hnisz
194575pRK5-mEGFP-RUNX1-MUTRUNX1 (Homo sapiens) Hnisz
200500pKLV2-U6gRNA5(RUNX1(11))-PGKpuro2ABFP-WRUNX1(11) (Homo sapiens) Yusa
200501pKLV2-U6gRNA5(RUNX1(13))-PGKpuro2ABFP-WRUNX1(13) (Homo sapiens) Yusa
205818CL20_mEGFP_ETV6_RUNX1ETV6_RUNX1 (Homo sapiens) Kriwacki
205914CL20_mEGFP_RUNX1_CBFA2T3RUNX1_CBFA2T3 (Homo sapiens) Kriwacki
205915CL20_mEGFP_RUNX1_RUNX1T1RUNX1_RUNX1T1 (Homo sapiens) Kriwacki
208569pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(12))-PGKpuroBFP-WRUNX1(13), RUNX3(12) (Homo sapiens) Yusa
208570pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(13))-PGKpuroBFP-WRUNX1(13), RUNX3(13) (Homo sapiens) Yusa